MYTUTOR SUBJECT ANSWERS

271 views

What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

Thomas D. A Level Biology tutor, GCSE Biology tutor, A Level Chemistr...

7 months ago

Answered by Thomas, a GCSE Biology tutor with MyTutor


Still stuck? Get one-to-one help from a personally interviewed subject specialist

258 SUBJECT SPECIALISTS

£22 /hr

Bobola A.

Degree: Medicine (MBChB - Bachelor of Medicine, Bachelor of Surgery) (Bachelors) - Liverpool University

Subjects offered:Biology, Human Biology+ 2 more

Biology
Human Biology
-Personal Statements-
-Medical School Preparation-

“I believe that genuine enthusiasm is the way in which we can inspire, encourage and teach students. It's what I plan to bring to all my tutoring sessions”

£18 /hr

Abhinav T.

Degree: Medicine (Other) - University College London University

Subjects offered:Biology, Physics+ 2 more

Biology
Physics
Maths
Chemistry

“Confirming understanding by verbal confirmation and communication so as to ensure clarity and confidence during the learning process and progression.”

MyTutor guarantee

£18 /hr

Sahil N.

Degree: Medicine (Bachelors) - Queen Mary, London ('13) University

Subjects offered:Biology, Maths+ 3 more

Biology
Maths
Chemistry
-Personal Statements-
-Medical School Preparation-

“About me: Hi there! I'm Sahil, a friendly and enthusiastic medical student at Barts and the London School of Medicine. Teaching has always been a wonderful passion of mine and I truly believe there is nothing more satisfying than help...”

About the author

£22 /hr

Thomas D.

Degree: Neuroscience (Bachelors) - Kings, London University

Subjects offered:Biology, Science+ 3 more

Biology
Science
Physics
Maths
Chemistry

“I am currently in my second year of a Neuroscience Bachellors' degree at a Russel Group institution, that is King's College London. Having done five (yes 5) A2s, and achieved an A* and 5 As, I know a few tricks of the trade so to spea...”

You may also like...

Posts by Thomas

How is the lung adapted for gaseous exchange?

What is the role of ATP in muscle contraction?

What is the structure of DNA?

Other GCSE Biology questions

How does the structure of the red blood cell allow it to carry out its functions?

What is an allele?

Describe how different environmental factors affect the direction of growth of roots and the direction of growth of shoots.

What does an organism use energy from respiration for?

View GCSE Biology tutors

We use cookies to improve your site experience. By continuing to use this website, we'll assume that you're OK with this. Dismiss

mtw:mercury1:status:ok