MYTUTOR SUBJECT ANSWERS

348 views

What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

Thomas D. A Level Biology tutor, GCSE Biology tutor, A Level Chemistr...

9 months ago

Answered by Thomas, a GCSE Biology tutor with MyTutor


Still stuck? Get one-to-one help from a personally interviewed subject specialist

308 SUBJECT SPECIALISTS

£22 /hr

Sanskrithi S.

Degree: Medicine (Other) - Oxford, University College University

Subjects offered:Biology, Maths+ 6 more

Biology
Maths
Chemistry
.UKCAT.
.BMAT (BioMedical Admissions)
-Personal Statements-
-Oxbridge Preparation-
-Medical School Preparation-

“I am a third year medical student at the University of Oxford whose aim is to support and guide students in their science studies.”

MyTutor guarantee

|  4 completed tutorials

£20 /hr

Akhil P.

Degree: Medicine (Bachelors) - Imperial College London University

Subjects offered:Biology, Physics+ 6 more

Biology
Physics
Maths
Chemistry
.UKCAT.
.BMAT (BioMedical Admissions)
-Personal Statements-
-Medical School Preparation-

“First Year Medical student at Imperial College. Studies all 3 sciences and Maths at A-levels and did an EPQ(4 A*s and an A)”

£22 /hr

Xanthe W.

Degree: Biological Sciences with a Year in Industry/Research (Bachelors) - Imperial College London University

Subjects offered:Biology, Maths+ 1 more

Biology
Maths
Chemistry

“Top tutor from the renowned Russell university group, ready to help you improve your grades.”

About the author

Thomas D.

Currently unavailable: for regular students

Degree: Neuroscience (Bachelors) - Kings, London University

Subjects offered:Biology, Science+ 3 more

Biology
Science
Physics
Maths
Chemistry

“I am currently in my second year of a Neuroscience Bachellors' degree at a Russel Group institution, that is King's College London. Having done five (yes 5) A2s, and achieved an A* and 5 As, I know a few tricks of the trade so to spea...”

You may also like...

Posts by Thomas

How is the lung adapted for gaseous exchange?

What is the role of ATP in muscle contraction?

What is the structure of DNA?

Other GCSE Biology questions

Describe the basic structure of a DNA and complementary base pairing.

How is body temperature regulated in mammals?

What is diffusion and why is it important in both animals and plants?

A young girl has recently been prescribed the combined contraceptive pill by her GP. This consists of oestrogen and progesterone. With regard to the menstrual cycle, what is the purpose of providing these hormones?

View GCSE Biology tutors

We use cookies to improve your site experience. By continuing to use this website, we'll assume that you're OK with this. Dismiss

mtw:mercury1:status:ok