What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

Answered by Thomas D. Biology tutor

2381 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

Explain how bacteria may become resistant to antibiotics


What is an enzyme? Explain the 'Lock and Key' Hypothesis


Name 3 differences between a plant cell and an animal cell.


What is Natural Selection?


We're here to help

contact us iconContact usWhatsapp logoMessage us on Whatsapptelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

© MyTutorWeb Ltd 2013–2024

Terms & Conditions|Privacy Policy