MYTUTOR SUBJECT ANSWERS

183 views

What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

Thomas D. A Level Biology tutor, GCSE Biology tutor, A Level Chemistr...

5 months ago

Answered by Thomas, a GCSE Biology tutor with MyTutor


Still stuck? Get one-to-one help from a personally interviewed subject specialist

252 SUBJECT SPECIALISTS

£18 /hr

William R.

Degree: Combined Honours in Arts (Bachelors) - Durham University

Subjects offered:Biology, Religious Studies+ 6 more

Biology
Religious Studies
Philosophy and Ethics
History
English Literature
-Personal Statements-

“About me: Hi, I'm Will, a second year Durham University Student. I currently study Combined Honours in Arts so: English, Philosophy, International Relations and History.  As you might be able to tell from my range of subjects, I love...”

£22 /hr

Katja H.

Degree: MA Geography and Politics (Bachelors) - Glasgow University

Subjects offered:Biology, Maths+ 3 more

Biology
Maths
Geography
French
English

“I'm a student of Geography and Politics at Glasgow Univeristy. I have always loved Geography and believe that studying it is like studying for a degree in interesting conversations :)My experience tutoring also includes Biology, Fren...”

£18 /hr

Satveer R.

Degree: Economics (Bachelors) - Leeds University

Subjects offered:Biology, Chemistry+ 1 more

Biology
Chemistry
-Personal Statements-

“I'm a friendly student at the University of Leeds with a passion for Mathems! I'd love to aid my students in achieving their goals and watching them excel :)”

MyTutor guarantee

About the author

£22 /hr

Thomas D.

Degree: Neuroscience (Bachelors) - Kings, London University

Subjects offered:Biology, Science+ 3 more

Biology
Science
Physics
Maths
Chemistry

“I am currently in my second year of a Neuroscience Bachellors' degree at a Russel Group institution, that is King's College London. Having done five (yes 5) A2s, and achieved an A* and 5 As, I know a few tricks of the trade so to spea...”

You may also like...

Posts by Thomas

How is the lung adapted for gaseous exchange?

What is the role of ATP in muscle contraction?

What is the structure of DNA?

Other GCSE Biology questions

What are the differences between mitosis and meiosis?

What are the products of digestion of a) proteins, b) fats and c) carbohydrates?

What is asexual reproduction and what are its features?

Describe how animals and plants are adapted to survive in dry conditions such as deserts.

View GCSE Biology tutors

We use cookies to improve your site experience. By continuing to use this website, we'll assume that you're OK with this. Dismiss

mtw:mercury1:status:ok