MYTUTOR SUBJECT ANSWERS

103 views

What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

Thomas D. A Level Biology tutor, GCSE Biology tutor, A Level Chemistr...

2 months ago

Answered by Thomas, a GCSE Biology tutor with MyTutor


Still stuck? Get one-to-one help from a personally interviewed subject specialist

186 SUBJECT SPECIALISTS

£20 /hr

Greg H.

Degree: Biomedical Science (Infectious Diseases) (Bachelors) - Edinburgh University

Subjects offered: Biology, French+ 1 more

Biology
French
English

“ About Me Hi! I'm Greg. I'm currently studying Biomedical Science at The University of Edinburgh, and I have a real passion for science and especially biology. I offer tuition in Biology and French from absolute beginners...”

£24 /hr

Andres R.

Degree: Chemistry (Masters) - Warwick University

Subjects offered: Biology, Chemistry

Biology
Chemistry

“Hi I'm Andrés, a chemistry student at the University of Warwick. I have just finished a research degree (MSc) at Warwick where I also studied for my bachelors in biomedical chemistry. I have much passion and enthusiasm for chemistry a...”

MyTutor guarantee

£22 /hr

Fiona T.

Degree: Global Health and Development (Masters) - University College London University

Subjects offered: Biology, Psychology+ 1 more

Biology
Psychology
-Personal Statements-

“About Me: I'm a Masters student studying a MSc in Global Health and Development at UCL. Previous to this I studied Biomedical Sciences at King's College London. I have a multidisciplinary background that will no doubt be beneficial, a...”

MyTutor guarantee

About the author

£18 /hr

Thomas D.

Degree: Neuroscience (Bachelors) - Kings, London University

Subjects offered: Biology, Science+ 3 more

Biology
Science
Physics
Maths
Chemistry

“I am currently in my second year of a Neuroscience Bachellors' degree at a Russel Group institution, that is King's College London. Having done five (yes 5) A2s, and achieved an A* and 5 As, I know a few tricks of the trade so to spea...”

You may also like...

Posts by Thomas

How is the lung adapted for gaseous exchange?

What is the role of ATP in muscle contraction?

What is the structure of DNA?

Other GCSE Biology questions

Explain why it is important to take a full course of prescribed antibiotics.

What is the difference between a macrophage and a monocyte?

What are alleles and what are their function?

Describe how water moves from roots to the leaves.

View GCSE Biology tutors

Cookies:

We use cookies to improve our service. By continuing to use this website, we'll assume that you're OK with this. Dismiss

mtw:mercury1:status:ok