MYTUTOR SUBJECT ANSWERS

225 views

What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

Thomas D. A Level Biology tutor, GCSE Biology tutor, A Level Chemistr...

6 months ago

Answered by Thomas, a GCSE Biology tutor with MyTutor


Still stuck? Get one-to-one help from a personally interviewed subject specialist

254 SUBJECT SPECIALISTS

£18 /hr

Davina B.

Degree: Information Management for Business (ITMB) (Bachelors) - Exeter University

Subjects offered:Biology, Science+ 3 more

Biology
Science
Music
Human Biology
French

“Enthusiastic Information Management for Business University student who loves Music. I play three instruments and took it at GCSE and A Level. ”

£18 /hr

George R.

Degree: Biology with Industrial Experience (Bachelors) - Manchester University

Subjects offered:Biology, Zoology+ 6 more

Biology
Zoology
Psychology
Maths
Human Biology
French
English Literature
-Personal Statements-

“Hardworking and enthusiastic people person that loves the subjects I tutor and loves to learn as well as teach!”

£30 /hr

Tabitha E.

Degree: Medicine (Bachelors) - Durham University

Subjects offered:Biology, Psychology+ 4 more

Biology
Psychology
History
Chemistry
-Personal Statements-
-Medical School Preparation-

“Hi, I'm Tabby, a medical student at the University of Durham. I would really love to help with anything and everything I can!”

About the author

Thomas D.

Currently unavailable: for new students

Degree: Neuroscience (Bachelors) - Kings, London University

Subjects offered:Biology, Science+ 3 more

Biology
Science
Physics
Maths
Chemistry

“I am currently in my second year of a Neuroscience Bachellors' degree at a Russel Group institution, that is King's College London. Having done five (yes 5) A2s, and achieved an A* and 5 As, I know a few tricks of the trade so to spea...”

You may also like...

Posts by Thomas

How is the lung adapted for gaseous exchange?

What is the role of ATP in muscle contraction?

What is the structure of DNA?

Other GCSE Biology questions

What are the four levels of protein structure? Please name and describe each level.

explain the circulation of blood pumped by the heart

What is meant by the 'circulation systems' in terms of blood flow?

what factors effect the rate of transpiration?

View GCSE Biology tutors

We use cookies to improve your site experience. By continuing to use this website, we'll assume that you're OK with this. Dismiss

mtw:mercury1:status:ok