MYTUTOR SUBJECT ANSWERS

152 views

What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

Thomas D. A Level Biology tutor, GCSE Biology tutor, A Level Chemistr...

4 months ago

Answered by Thomas, a GCSE Biology tutor with MyTutor


Still stuck? Get one-to-one help from a personally interviewed subject specialist

242 SUBJECT SPECIALISTS

£24 /hr

Roshni R.

Degree: Dentistry (Bachelors) - Birmingham University

Subjects offered: Biology, Spanish+ 4 more

Biology
Spanish
Maths
Chemistry
-Personal Statements-
-Medical School Preparation-

“Tutoring approach Professional but friendly approach.  Work with my students to identify the areas the student is finding most difficult. Review the topic with my hand-written notes.  Explain any misunderstood areas. Work through examp...”

£18 /hr

Matilda C.

Degree: Medicine (Bachelors) - Edinburgh University

Subjects offered: Biology, Science+ 4 more

Biology
Science
Maths
Chemistry
.UKCAT.
-Medical School Preparation-

“Hi, my name's Matilda and I'm a third year, cricket-loving medical student at the University of Edinburgh. I have a genuine love of helping other people and doing my very best of have a positive impact on their lives; this is at the c...”

MyTutor guarantee

£18 /hr

Maria B.

Degree: Natural Sciences with French (Bachelors) - Birmingham University

Subjects offered: Biology, Science+ 3 more

Biology
Science
Physics
French
Chemistry

“I am a first-class graduate in Natural Sciences and French from the University of Birmingham. I have always had a passion for sciences and languages and enjoy helping others to understand and learn. I am extremely patient, friendly and...”

About the author

£20 /hr

Thomas D.

Degree: Neuroscience (Bachelors) - Kings, London University

Subjects offered: Biology, Science+ 3 more

Biology
Science
Physics
Maths
Chemistry

“I am currently in my second year of a Neuroscience Bachellors' degree at a Russel Group institution, that is King's College London. Having done five (yes 5) A2s, and achieved an A* and 5 As, I know a few tricks of the trade so to spea...”

You may also like...

Posts by Thomas

How is the lung adapted for gaseous exchange?

What is the role of ATP in muscle contraction?

What is the structure of DNA?

Other GCSE Biology questions

Explain the process of allopatric speciation

What is mitosis?

What are the functional differences between RNA and DNA

What is an allele?

View GCSE Biology tutors

Cookies:

We use cookies to improve our service. By continuing to use this website, we'll assume that you're OK with this. Dismiss

mtw:mercury1:status:ok