MYTUTOR SUBJECT ANSWERS

39 views

What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

Thomas D. A Level Biology tutor, GCSE Biology tutor, A Level Chemistr...

1 month ago

Answered by Thomas, a GCSE Biology tutor with MyTutor

Still stuck? Get one-to-one help from a personally interviewed subject specialist

185 SUBJECT SPECIALISTS

£18 /hr

Jack R.

Degree: Medicine (Bachelors) - Manchester University

Subjects offered: Biology, .UKCAT.

Biology
.UKCAT.

“Hi there! About me: My name is Jack, and I am currently a medical student at the  University of Manchester, UK. I am from the Peak District, and love the great outdoors, from cycling to skiing and everything imbetween. I an enthusiast...”

£18 /hr

Steven A.

Degree: Bioscience (Masters) - Durham University

Subjects offered: Biology, Science+ 5 more

Biology
Science
Maths
Human Biology
English
Chemistry
-Personal Statements-

“Hey! I'm Steven, 18 years old and I'm studying Biochemistry at Durham University. I love tutoring people, to put it simply. At my college i was a tutor to a student in the year below me for chemistry and growing up with a younger sist...”

£18 /hr

Alexander A.

Degree: Molecular Cell Biology (with a year in industry) (Bachelors) - York University

Subjects offered: Biology, Physics+ 1 more

Biology
Physics
Maths

“I am an enthusiastic and patient tutor with a love for science that I want to share!  I am currently reading molecular cell biology at the University of York. I have had previous experiencing tutoring at A-level peer mentoring as part...”

MyTutor guarantee

About the author

£18 /hr

Thomas D.

Degree: Neuroscience (Bachelors) - Kings, London University

Subjects offered: Biology, Physics+ 3 more

Biology
Physics
Maths
ICT
Chemistry

“I am currently in my second year of a Neuroscience Bachellors' degree at a Russel Group institution, that is King's College London. Having done five (yes 5) A2s, and achieved an A* and 5 As, I know a few tricks of the trade so to spea...”

You may also like...

Posts by Thomas

How is the lung adapted for gaseous exchange?

What is the role of ATP in muscle contraction?

What is the structure of DNA?

Other GCSE Biology questions

Outline the lock and key mechanism of enzyme-controlled reactions

Describe how different environmental factors affect the direction of root and shoot growth in plants. You should refer to the role of plant hormones.

What are the differences between the nervous and endocrine systems in maintaining homeostasis?

How does antibiotic resistance relate to evolution?

View GCSE Biology tutors

Cookies:

We use cookies to improve our service. By continuing to use this website, we'll assume that you're OK with this. Dismiss

mtw:mercury1:status:ok