MYTUTOR SUBJECT ANSWERS

386 views

What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

Thomas D. A Level Biology tutor, GCSE Biology tutor, A Level Chemistr...

11 months ago

Answered by Thomas, a GCSE Biology tutor with MyTutor


Still stuck? Get one-to-one help from a personally interviewed subject specialist

377 SUBJECT SPECIALISTS

£18 /hr

Valentina G.

Degree: Biology (Masters) - York University

Subjects offered:Biology, Italian

Biology
Italian

“Studying Biology is extremely interesting but also challenging, that is why I want to help to allow students to look past challenging and focus on interesting!”

Trusted by schools

|  2 completed tutorials

£20 /hr

Chaitya D.

Degree: Medicine A100 (Bachelors) - Liverpool University

Subjects offered:Biology, Science+ 6 more

Biology
Science
Physics
Maths
Chemistry
.UKCAT.
-Personal Statements-
-Medical School Preparation-

“Hi, I'm Chai and I'm a fifth year medical student that is passionate about helping students achieve the best of their potential!”

£18 /hr

Axel R.

Degree: Biochemistry with Management (Bachelors) - Imperial College London University

Subjects offered:Biology, Science+ 2 more

Biology
Science
Maths
Chemistry

“Postgraduate student keen on helping you understand Maths and Science! No matter the level, you CAN succeed!”

MyTutor guarantee

About the author

Thomas D.

Currently unavailable: for regular students

Degree: Neuroscience (Bachelors) - Kings, London University

Subjects offered:Biology, Science+ 4 more

Biology
Science
Physics
Maths
Chemistry
.UKCAT.

“An experienced tutor of the sciences and the UKCAT. More than happy to help with GCSE and A level.”

You may also like...

Posts by Thomas

How is the lung adapted for gaseous exchange?

What is the role of ATP in muscle contraction?

What is the structure of DNA?

Other GCSE Biology questions

Describe the hormonal control over the menstrual cycle in females.

Describe the 'reflex arc'

What is the difference between diffusion, osmosis and active transport?

What happens to the blood when it enters the heart?

View GCSE Biology tutors

We use cookies to improve your site experience. By continuing to use this website, we'll assume that you're OK with this. Dismiss

mtw:mercury1:status:ok