What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for C and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD

Related Biology GCSE answers

All answers ▸

What are is the function of a ribosomes and what is it made from?


What is the structure and function of neurones?


What is the structure and features of a DNA molecule


Describe the stages of mitosis.