What is the structure of DNA?
DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G
Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for C and G.
Example:
ATTCGCCAAATTCCCCGATTGGG
TAAGCGGTTTAAGGGGCTAACCC
TD
Related Biology GCSE answers
All answers ▸What is the role of white blood cells in the immune system?
what are enzymes?
Give three reasons for why biomass may not be transferred from primary consumers to organisms at higher trophic levels in the food chain. [3 marks]
What is a reflex and what do you mean by a reflex arc? (both "reflex" and "reflex arc" are on the CCEArevised GCSE Biology specification)