What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD

Related Biology GCSE answers

All answers ▸

Describe how living plants are involved in the carbon cycle.


What is a chloroplast?


What are Mendel's two laws of inheritance?


Why is surface area to volume ratio bigger in smaller animals and vice versa?