What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

Answered by Thomas D. Biology tutor

2377 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

How do motor neurones work?


Most cases of scarlet fever occur in children. Adults have usually developed immunity to a toxin that the Streptococcus bacteria produce during infection. Explain how an adult develops immunity.


What are the advantages of animals eating excess food and putting on weight for winter?


Describe how information passes across a synapse


We're here to help

contact us iconContact usWhatsapp logoMessage us on Whatsapptelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

© MyTutorWeb Ltd 2013–2024

Terms & Conditions|Privacy Policy