What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD

Related Biology GCSE answers

All answers ▸

Explain the difference between a passive process and an active process.


Describe how deforestation is causing the change in the amounts of different gasses in the atmosphere


What is a virus?


How does the body respond to raise its core body temprature?