What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD

Related Biology GCSE answers

All answers ▸

What is the chemical equation for aerobic respiration


What is Homeostasis and how does it work?


Why does the rate of an enzyme reaction not just always increase with temperature? Why does it fall after a point?


What is the action of insulin?