What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3514 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

Describe the role of bile in the digestive system


Doctors are now prescribing fewer antibiotics to reduce the evolution of antibiotic resistant bacteria. Describe the process of evolution of antibiotic bacteria. [6 marks]


How does concentration gradient affect the rate of diffusion?


What is peristalsis?


We're here to help

contact us iconContact ustelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

MyTutor is part of the IXL family of brands:

© 2025 by IXL Learning