What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3410 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

How would you investigate the effect of light intensity on the rate of photosynthesis in pondweed? [6]


List 5 features of an animal cell and the function they have within the cell


Describe how information passes across a synapse


What happens to the arteries in coronary heart disease?


We're here to help

contact us iconContact ustelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

MyTutor is part of the IXL family of brands:

© 2025 by IXL Learning