What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3421 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

How are blood glucose levels regulated in the body?


Describe the reflex arc in response to the hand touching a burning hot stove. Include the names and a description of location and function of all neurons involved. Bullet points are sufficient.


How is the concentration of blood and urine controlled by the body? (6 marker)


Use a genetic diagram to work out the probability that the offspring have cystic fibrosis if both parents are carriers.


We're here to help

contact us iconContact ustelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

MyTutor is part of the IXL family of brands:

© 2025 by IXL Learning