What is the structure of DNA?
DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G
Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for C and G.
Example:
ATTCGCCAAATTCCCCGATTGGG
TAAGCGGTTTAAGGGGCTAACCC
TD
Related Biology GCSE answers
All answers ▸How does vaccination make a person immune to a disease?
Translation occurs in living cells. Explain how translation is carried out, from the initiation stage onwards.
What is a gene?
Why does the mass of a potato chip decrease after it is left in a concentrated sugar solution?