What is the structure of DNA?
DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G
Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for C and G.
Example:
ATTCGCCAAATTCCCCGATTGGG
TAAGCGGTTTAAGGGGCTAACCC
TD
Related Biology GCSE answers
All answers ▸Describe different point mutations and how severe are they likely to be
what are enzymes?
Describe the difference between genotype and phenotype and give an example of where two different genetoypes may give rise to the same phenotype.
List 5 features of an animal cell and the function they have within the cell