What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3539 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

Describe how water moves through the cells of a plant


Compare the similarities and differences between animal and plant cells? (6 marks)


Describe how blood vessels are able to assist in the control of body temperature.


What is homeostasis? Can you use a couple of examples to explain the difference between positive vs negative feedback?


We're here to help

contact us iconContact ustelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

MyTutor is part of the IXL family of brands:

© 2025 by IXL Learning