What is the structure of DNA?

  • Google+ icon
  • LinkedIn icon
  • 420 views

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

Thomas D. A Level Biology tutor, GCSE Biology tutor, A Level Chemistr...

About the author

is an online GCSE Biology tutor with MyTutor studying at Kings, London University

How MyTutor Works

Still stuck? Get one-to-one help from a personally interviewed subject specialist.

95% of our customers rate us

Browse tutors

We use cookies to improve your site experience. By continuing to use this website, we'll assume that you're OK with this. Dismiss

mtw:mercury1:status:ok