What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3222 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

How do species change over time?


How would a reduced level of chlorphyll in a plant cause a stunted growth? Can anything else affect growth?


Explain the lock and key model of enzyme action, including how they are denatured


What is photosynthesis? Where does it occur? What are the reactants and products of the process?


We're here to help

contact us iconContact usWhatsapp logoMessage us on Whatsapptelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

© MyTutorWeb Ltd 2013–2025

Terms & Conditions|Privacy Policy
Cookie Preferences