What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3843 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

Plants require nitrates for growth. To maximise crop yield, farmers utilise techniques such as crop rotation and ploughing of fields prior to planting their seedlings. Explain how the two techniques mentioned improve plant yield:


How does respiration occur in living cells?


Describe the process of evolution by natural selection


What is a synapse?


We're here to help

contact us iconContact ustelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

MyTutor is part of the IXL family of brands:

© 2026 by IXL Learning