What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3867 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

Describe the impulse process in a simple reflex action


How are action potentials transmitted?


What is asexual reproduction and what are its features?


Describe the pathway of blood flow through the pulmonary circuit


We're here to help

contact us iconContact ustelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

MyTutor is part of the IXL family of brands:

© 2026 by IXL Learning