What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3322 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

What are the main differences between prokaryotes and eukaryotes?


Explain how the use of antibiotics might lead to a resistant strain of bacteria arising.


What are the differences between prokaryotic and eukaryotic cells?


What is the difference between aerobic respiration and anaerobic respiration?


We're here to help

contact us iconContact ustelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

© MyTutorWeb Ltd 2013–2025

Terms & Conditions|Privacy Policy
Cookie Preferences