What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD

Related Biology GCSE answers

All answers ▸

Explain how blood vessels reduce the amount of heat lost from the body. (3)


What is osmosis


How is DNA linked to protein synthesis? Why does mutations in DNA have serious implications on protein synthesis?


Describe the function of the heart