What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3766 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

Explain what is meant by 'homeostasis' and give an example of this process in the human body.


Describe the changes in pupil size when light is shined into the eye. Explain why this happens.


What do you understand by gene cloning?


What is diffusion?


We're here to help

contact us iconContact ustelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

MyTutor is part of the IXL family of brands:

© 2026 by IXL Learning