What is the structure of DNA?
DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G
Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for C and G.
Example:
ATTCGCCAAATTCCCCGATTGGG
TAAGCGGTTTAAGGGGCTAACCC
TD
Related Biology GCSE answers
All answers ▸Resistance to antibiotics is increasing. How can we help prevent antibiotic resistance developing? (2 marks)
A diabetes patient injects insulin before meals. State whether the patient has Type 1 or Type 2 diabetes and explain why?
What is negative feedback?
How does the heart pump oxygenated blood around the body?