What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3589 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

Resistance to antibiotics is increasing. How can we help prevent antibiotic resistance developing? (2 marks)


What is the difference between mitosis and meiosis?


Antibiotics can be used to protect our bodies from pathogens: What is a pathogen?


Describe why a person with type 2 diabetes would struggle to control their blood sugar


We're here to help

contact us iconContact ustelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

MyTutor is part of the IXL family of brands:

© 2025 by IXL Learning