What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3643 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

Explain the 3 types of DNA mutation substitution?


Explain the three stages of drug testing.


What is a pathogen and what are the 4 main types of pathogen?


If blood glucose level is high, how does it return back to normal?


We're here to help

contact us iconContact ustelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

MyTutor is part of the IXL family of brands:

© 2026 by IXL Learning