What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD

Related Biology GCSE answers

All answers ▸

How do enzymes work?


Describe how someone with breast cancer could go on to develop lung cancer (3 marks)


What conditions increase the likelihood of fossilisation?


Explain the process of speciation