What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3283 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

What can happen to a red blood cell if placed into a solution that is more dilute than its own cell contents?


Why was Charles Darwin's theory of evolution by natural selection not accepted at the time?


Describe three ways in which the body maintains its temperature in different climates


Name two structural differences between arteries and veins.


We're here to help

contact us iconContact ustelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

© MyTutorWeb Ltd 2013–2025

Terms & Conditions|Privacy Policy
Cookie Preferences