What is the structure of DNA?
DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G
Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for C and G.
Example:
ATTCGCCAAATTCCCCGATTGGG
TAAGCGGTTTAAGGGGCTAACCC
TD
Related Biology GCSE answers
All answers ▸What are indicator species and what are they used for?
Using your knowledge of the Circulatory System, describe & explain how and why an increase in intensity of exercise leads to an increased heart rate.
If blood glucose level is high, how does it return back to normal?
Briefly describe how a vaccine works.