What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3913 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

How are blood glucose levels regulated in the body?


Explain the meaning of the terms (a) gene and (b) allele


Give methods used in the factory farming of animals. Explain the advantages and disadvantages of these methods


Explain why damaged villi may result in poor growth (4 marks)


We're here to help

contact us iconContact ustelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

MyTutor is part of the IXL family of brands:

© 2026 by IXL Learning