What is the structure of DNA?
DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G
Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for C and G.
Example:
ATTCGCCAAATTCCCCGATTGGG
TAAGCGGTTTAAGGGGCTAACCC
TD
Related Biology GCSE answers
All answers ▸Explain the role of anti-diuretic hormone in the production of concentrated urine
i) Briefly explain the difference between anaerobic and aerobic respiration (2). ii) Which of these reactions produce more energy and briefly describe why?(2)
What is the difference between the central nervous system and the peripheral nervous system
How is the small intestine adapted for efficient absorption?