What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3450 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

What happens to the arteries in coronary heart disease?


Explain the lock and key model of enzyme action, including how they are denatured.


What is the role of bile in digestion?


Bob and Brenda are both heterozygous for a genetically inherited recessive trait. (a) Calculate the probability that they would have a healthy child. Use a genetic diagram to help. (b) Suggest an example of a recessive inherited disorder


We're here to help

contact us iconContact ustelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

MyTutor is part of the IXL family of brands:

© 2025 by IXL Learning