What is the structure of DNA?
DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G
Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for C and G.
Example:
ATTCGCCAAATTCCCCGATTGGG
TAAGCGGTTTAAGGGGCTAACCC
TD
Related Biology GCSE answers
All answers ▸Megapode birds open and close the air vents of the nest at different times of the day. Suggest reasons why it is necessary to open and close the air vents.
Describe the factors which affect rate of reaction.
What is a control in an experiment?
Evaluate the pros and cons of breastfeeding.