What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3570 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

What are the main differences between prokaryotes and eukaryotes?


What is the structure and function of a nerve cell?


Explain how a vaccination prevents infection [3 marks]


Briefly describe the stages of mitosis


We're here to help

contact us iconContact ustelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

MyTutor is part of the IXL family of brands:

© 2025 by IXL Learning