What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3554 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

What are embryonic stem cells? Why are stem cells useful to doctors + why this discovery may make fewer people object to their use


What’s the difference between characteristics caused by environmental and genetic factors?


Describe how a sperm cell is adapted to its role (4 marks)


How does the body respond to raise its core body temprature?


We're here to help

contact us iconContact ustelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

MyTutor is part of the IXL family of brands:

© 2025 by IXL Learning