What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3472 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

What is a concentration gradient?


How is blood pumped around the body through the heart?


a) Plants need energy to make glucose. How do plants get this energy?


Describe how selective breeding could be used to improve the volume of milk produced by cows.


We're here to help

contact us iconContact ustelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

MyTutor is part of the IXL family of brands:

© 2025 by IXL Learning