What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3715 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

Which of these is a correctly balanced equation for respiration? C6H12O6 + 3O2 → CO2 + 3H2O C6H12O6 + 6O2 → 6CO2+ 6H2O C6H12O6 + 6O2 → 6CO2 + 3H2O


Describe the similarities and differences in form between DNA and RNA


What are the differences between aerobic and anaerobic respiration in animals?


What is an enzyme?


We're here to help

contact us iconContact ustelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

MyTutor is part of the IXL family of brands:

© 2026 by IXL Learning