What is the structure of DNA?
DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G
Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for C and G.
Example:
ATTCGCCAAATTCCCCGATTGGG
TAAGCGGTTTAAGGGGCTAACCC
TD
Related Biology GCSE answers
All answers ▸How do prokaryotes differ from eukaryotes?
How are root hair cells specialised to carry out their function?
List the main structural differences between a typical animal, plant and bacteria cell
Why does glucose pass into the kidney but red blood cells and protein do not?