What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3374 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

What is the equation for respiration?


Identify the various structures in a reflex arc in the context of a pin prick. What is the end response and why is this beneficial?


What are the effects of exercise on the body?


i) Briefly explain the difference between anaerobic and aerobic respiration (2). ii) Which of these reactions produce more energy and briefly describe why?(2)


We're here to help

contact us iconContact ustelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

MyTutor is part of the IXL family of brands:

© 2025 by IXL Learning