What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3736 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

What is the process by which vaccines protect individuals against infectious diseases?


describe how the plant hormone auxin and light affects the direction of growth of plants


What is the difference between meiosis and mitosis?


Describe the difference between the function of an effector and receptor, giving an example of each.


We're here to help

contact us iconContact ustelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

MyTutor is part of the IXL family of brands:

© 2026 by IXL Learning