What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3577 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

Describe adaptations of plants that live in dry conditions, such as the desert.


Describe two ways in which nervous communication differs from hormonal communication


How are leaves adapted for gas exchange?


"Hormones are secreted by endocrine glands." Explain the meaning of this statement.


We're here to help

contact us iconContact ustelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

MyTutor is part of the IXL family of brands:

© 2025 by IXL Learning