What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3923 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

What's the difference between aerobic and anaerobic respiration?


Respiration transfers energy from glucose for muscle contraction. Describe how glucose from the small intestine is moved to a muscle cell.


Ella has just finished running a half marathon. She hasn't been drinking enough water so is dehydrated and is feeling incredibly hot. Describe how her body responds to these changes. (6)


How do you calculate the magnification of an image? For example, if the real size of a cell is 30um and the size of the cell in the textbook is 60mm, what is the magnification?


We're here to help

contact us iconContact ustelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

MyTutor is part of the IXL family of brands:

© 2026 by IXL Learning