What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3273 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

What are mitochondria and ribosomes and what are their function?


Can a man with haemophilia pass it onto a) his son or b) his grandson?


Explain how you would expect glycogen levels in the liver to change after a meal, and why it would change in that way.


Explain how a leaky heart valve can cause health issues


We're here to help

contact us iconContact ustelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

© MyTutorWeb Ltd 2013–2025

Terms & Conditions|Privacy Policy
Cookie Preferences