What is the structure of DNA?
DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G
Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for C and G.
Example:
ATTCGCCAAATTCCCCGATTGGG
TAAGCGGTTTAAGGGGCTAACCC
TD
Related Biology GCSE answers
All answers ▸Describe how starch is digested mechanically and chemically from the time we eat it in our mouth until it reaches our small intestine where it's absorbed.
What is the difference between osmosis and active transport?
Explain the hormones involved in the menstrual cycle from day 1-14 of the cycle.
Animals and plants have features (adaptations) that allow them to survive in the conditions in which they normally live. Describe how animals and plants are adapted to survive in dry conditions such as deserts. For each adaptation that you give, describ