What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3647 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

What is an Extremophile?


What is the difference between genotype and phenotype?


How are living organisms involved in the cycling of carbon?


What are the main differences in composition of blood taken from an artery to blood taken from a vein?


We're here to help

contact us iconContact ustelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

MyTutor is part of the IXL family of brands:

© 2026 by IXL Learning