What is the structure of DNA?
DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G
Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for C and G.
Example:
ATTCGCCAAATTCCCCGATTGGG
TAAGCGGTTTAAGGGGCTAACCC
TD
Related Biology GCSE answers
All answers ▸What is the function of a chloroplast?
Which food chain has the highest proportion of energy transfer. Grass -> cow -> human. Grass -> grasshopper -> rat -> snake. Rice -> human
What is a mutation and how do they affect proteins?
Describe the process of Mitosis?