What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3184 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

What is autosomal dominant and recessive inheritance?


Compare the structural differences between arteries, veins and capillaries and how each difference helps efficient blood transport


What is the difference between mitosis and meiosis?


Mutations can occur in DNA. Describe what effect a mutation can have on the function of an enzyme.


We're here to help

contact us iconContact usWhatsapp logoMessage us on Whatsapptelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

© MyTutorWeb Ltd 2013–2025

Terms & Conditions|Privacy Policy
Cookie Preferences