What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD

Related Biology GCSE answers

All answers ▸

Explain the process and mechanisms underpinning gas exchange in animal bodies.


What is a stem cell?


Describe how insulin returns the blood glucose concentration to normal.


What is the function of enzymes and give an example of one.