What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3543 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

What is the main gas in bacteria produced biogas?


Draw a diagram showing a normal iris and what happens to the iris when a light in shined into the human eye. (1 mark). What causes this to happen? (2 marks)


What are dominant vs recessive alleles?


Describe the process of gene transcription?


We're here to help

contact us iconContact ustelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

MyTutor is part of the IXL family of brands:

© 2025 by IXL Learning