What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3680 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

A man has a disease caused by a dominant allele. The mother has the disease but the father does not, explain how we know the man is heterozygous for this disease.


What is the function of the waxy cuticle?


What's the difference between aerobic and anaerobic respiration?


Explain how two different species of rabbits could have developed from a common ancestor?


We're here to help

contact us iconContact ustelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

MyTutor is part of the IXL family of brands:

© 2026 by IXL Learning