What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3270 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

Explain the diffusion process of gas exchange in the lung during respiration


A large amount of untreated sewage entered the river. Many fish died. Untreated sewage contains organic matter and bacteria. Explain why many fish died. (5)


How do species change over time?


What is phagocytosis?


We're here to help

contact us iconContact ustelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

© MyTutorWeb Ltd 2013–2025

Terms & Conditions|Privacy Policy
Cookie Preferences