What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

Answered by Thomas D. Biology tutor

2423 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

A large amount of untreated sewage entered the river. Many fish died. Untreated sewage contains organic matter and bacteria. Explain why many fish died. (5)


Explain the process and mechanisms underpinning gas exchange in animal bodies.


Describe how deoxygenated blood flows through the heart


What is a synapse and how does it work?


We're here to help

contact us iconContact usWhatsapp logoMessage us on Whatsapptelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

© MyTutorWeb Ltd 2013–2024

Terms & Conditions|Privacy Policy