What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3642 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

Describe the measures the body takes to achieve homeostasis in response to temperature changes


Why does the rate of an enzyme reaction not just always increase with temperature? Why does it fall after a point?


Explain why it is important to take a full course of prescribed antibiotics.


What are latin binomials and why do we use them?


We're here to help

contact us iconContact ustelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

MyTutor is part of the IXL family of brands:

© 2026 by IXL Learning