What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

Answered by Thomas D. Biology tutor

2412 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

What is the structure of DNA?


Different enzymes catalyse specific reactions. Explain why enzymes can only catalyse specific reactions.


How do the kidneys control the volume of water in our bodies?


I'm not sure how to answer the longer-answered questions e.g. those that are 6 marks.


We're here to help

contact us iconContact usWhatsapp logoMessage us on Whatsapptelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

© MyTutorWeb Ltd 2013–2024

Terms & Conditions|Privacy Policy