What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3638 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

Describe different point mutations and how severe are they likely to be


Explain the process on mitosis


How are the different types of blood vessel adapted to their function in the circulatory system?


Describe two ways the body prevents the entry of microorganisms.


We're here to help

contact us iconContact ustelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

MyTutor is part of the IXL family of brands:

© 2026 by IXL Learning